Skip to product information
1 of 1

S. pyogenes Cas9 NLS

S. pyogenes Cas9 NLS

Catalog Number: UA079022 Brand: UA BIOSCIENCE
Price:
Regular price $680 USD
Regular price Sale price $680 USD
Size:
For shipping services or bulk orders, you may request a quotation.
Secure checkout with
View full details

Product Details

Product Specification


Amino Acid Sequence

APKKKRKVGIHGVPAADKKYSIGLDIGTNSVGWAVITDEYKVPSKKFKVLGNTDRHSIKKNLIGALLFDSGETAEATRLKRTARRRYTRRKNRICYLQEIFSNEMAKVDDSFFHRLEESFLVEEDKKHERHPIFGNIVDEVAYHEKYPTIYHLRKKLVDSTDKADLRLIYLALAHMIKFRGHFLIEGDLNPDNSDVDKLFIQLVQTYNQLFEENPINASGVDAKAILSARLSKSRRLENLIAQLPGEKKNGLFGNLIALSLGLTPNFKSNFDLAEDAKLQLSKDTYDDDLDNLLAQIGDQYADLFLAAKNLSDAILLSDILRVNTEITKAPLSASMIKRYDEHHQDLTLLKALVRQQLPEKYKEIFFDQSKNGYAGYIDGGASQEEFYKFIKPILEKMDGTEELLVKLNREDLLRKQRTFDNGSIPHQIHLGELHAILRRQEDFYPFLKDNREKIEKILTFRIPYYVGPLARGNSRFAWMTRKSEETITPWNFEEVVDKGASAQSFIERMTNFDKNLPNEKVLPKHSLLYEYFTVYNELTKVKYVTEGMRKPAFLSGEQKKAIVDLLFKTNRKVTVKQLKEDYFKKIECFDSVEISGVEDRFNASLGTYHDLLKIIKDKDFLDNEENEDILEDIVLTLTLFEDREMIEERLKTYAHLFDDKVMKQLKRRRYTGWGRLSRKLINGIRDKQSGKTILDFLKSDGFANRNFMQLIHDDSLTFKEDIQKAQVSGQGDSLHEHIANLAGSPAIKKGILQTVKVVDELVKVMGRHKPENIVIEMARENQTTQKGQKNSRERMKRIEEGIKELGSQILKEHPVENTQLQNEKLYLYYLQNGRDMYVDQELDINRLSDYDVDHIVPQSFLKDDSIDNKVLTRSDKNRGKSDNVPSEEVVKKMKNYWRQLLNAKLITQRKFDNLTKAERGGLSELDKAGFIKRQLVETRQITKHVAQILDSRMNTKYDENDKLIREVKVITLKSKLVSDFRKDFQFYKVREINNYHHAHDAYLNAVVGTALIKKYPKLESEFVYGDYKVYDVRKMIAKSEQEIGKATAKYFFYSNIMNFFKTEITLANGEIRKRPLIETNGETGEIVWDKGRDFATVRKVLSMPQVNIVKKTEVQTGGFSKESILPKRNSDKLIARKKDWDPKKYGGFDSPTVAYSVLVVAKVEKGKSKKLKSVKELLGITIMERSSFEKNPIDFLEAKGYKEVKKDLIIKLPKYSLFELENGRKRMLASAGELQKGNELALPSKYVNFLYLASHYEKLKGSPEDNEQKQLFVEQHKHYLDEIIEQISEFSKRVILADANLDKVLSAYNKHRDKPIREQAENIIHLFTLTNLGAPAAFKYFDTTIDRKRYTSTKEVLDATLIHQSITGLYETRIDLSQLGGDKRPAATKKAGQAKKKK

Expression System E.coli
Molecular Weight

The recombinant SpCas9 NLS consists of 1399 amino acids and has a predicted molecular mass of 161.7 kDa.

Purity ≥ 97% by SDS-PAGE gel analyses.
Endotoxin <0.1EU/μg
Tag No Tag
Physical Appearance Liquid
Storage Buffer

10 mM Tris-HCl pH 7.5, 300 mM NaCl, 0.1 mM EDTA, 1.0 mM TCEP, 50% glycerol.

Stability & Storage

Please use a manual defrost freezer and avoid repeated freeze-thaw cycles.

24 months from date of receipt, -20 to -70 °C as supplied.

12 months, -20 to -70 °C under sterile conditions after opening.

Protocol

Activity Assay Protocol

Materials

Assay Buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg/mL BSA, pH 7.9

Recombinant S. pyogenes Cas9 NLS

DNA Substrate: PBR322 vector digested with EcoRI Synthetic sgRNA, targeting sequence:, targeting sequence: GAGGCAGACAAGGTATAGGG

Ethidium Bromide, 10 mg/mL

Ultrapure DNase/RNase-Free Distilled Water, to prepare Assay Buffer

Assay

1. Prepare RNP Complex:

a. 600 nM sgRNA (6 µL addition from 3 µM stock prepared in Assay Buffer)

b. 0.25μg rSpCas9 NLS

c. Add Assay Buffer for a final RNP Complex volume of 26.5 µL

d. Incubate for 5 minutes at 37 °C.

2. Mix RNP Complex with 3.5 μL of 8.6 ng/µL of DNA Substrate (diluted in Assay Buffer, if possible).

3. Incubate for 1 hour at 37 °C.

4. Incubate for 10 minutes at 65 °C to dissociate enzyme from DNA.

5. Load total reaction with loading dye on a 1% agarose gel.

6. Run gel at 140 V for 40 minutes.

7. Soak gel in 200 mL TAE with 150 μL of 10 mg/mL ethidium bromide for 1 hour.

8. Use imaging software to detect and quantify hydrolysis of the DNA substrate.

Customer Reviews

Be the first to write a review
0%
(0)
0%
(0)
0%
(0)
0%
(0)
0%
(0)